Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Adenovirus-mediated siRNA targeting TNF-α and overexpression of bone morphogenetic protein-2 promotes early osteoblast differentiation on a cell model of Ti particle-induced inflammatory response in vitro

Wear particles are phagocytosed by macrophages and other inflammatory cells, resulting in cellular activation and release of proinflammatory factors, which cause periprosthetic osteolysis and subsequent aseptic loosening, the most common causes of total joint arthroplasty failure. During this pathological process, tumor necrosis factor-alpha (TNF-α) plays an important role in wear-particle-induced osteolysis. In this study, recombination adenovirus (Ad) vectors carrying both target genes [TNF-α small interfering RNA (TNF-α-siRNA) and bone morphogenetic protein 2 (BMP-2)] were synthesized and transfected into RAW264.7 macrophages and pro-osteoblastic MC3T3-E1 cells, respectively. The target gene BMP-2, expressed on pro-osteoblastic MC3T3-E1 cells and silenced by the TNF-α gene on cells, was treated with titanium (Ti) particles that were assessed by real-time PCR and Western blot. We showed that recombinant adenovirus (Ad-siTNFα-BMP-2) can induce osteoblast differentiation when treated with conditioned medium (CM) containing RAW264.7 macrophages challenged with a combination of Ti particles and Ad-siTNFα-BMP-2 (Ti-ad CM) assessed by alkaline phosphatase activity. The receptor activator of nuclear factor-κB ligand was downregulated in pro-osteoblastic MC3T3-E1 cells treated with Ti-ad CM in comparison with conditioned medium of RAW264.7 macrophages challenged with Ti particles (Ti CM). We suggest that Ad-siTNFα-BMP-2 induced osteoblast differentiation and inhibited osteoclastogenesis on a cell model of a Ti particle-induced inflammatory response, which may provide a novel approach for the treatment of periprosthetic osteolysis.

Be alert to the alterations in the biological characteristics in heterogeneous vancomycin-intermediate Staphylococcus aureus.

The development of reduced vancomycin susceptibility in Staphylococcus aureus in many cases appears to be associated with characteristic changes. These changes may have pitfall of identifying S. aureus by automated testing methods like Vitek 32. In this study, we retested 24 heterogeneous vancomycin-intermediate Staphylococcus haemolyticus (h-VISH) collected in 2008-2010 at the Department of Clinical Microbiology by conventional biochemical tests and polymerase chain reaction (PCR). The heterogeneous vancomycin-intermediate S. aureus (hVISA) reversion test and electron microscopic examination were also used. Six isolates of 24 h-VISH possessed nuc, coa, and 16S rRNA genes, and could be reversed into S. aureus. It suggested that biochemical and morphological changes in hVISA and vancomycin-intermediate S. aureus (VISA) should be considered, and the detection of S. aureus, especially reduced vancomycin susceptibility isolates, requires more attention and different techniques.

Therapeutic effects of Sophora moorcroftiana alkaloids in combination with albendazole in mice experimentally infected with protoscolices of Echinococcus granulosus

The objective of the present study was to determine if the combination of alkaloids from Sophora moorcroftiana seeds and albendazole might be effective in the treatment of experimental echinococcosisin female NIH mice (6 weeks old and weighing 18-20 g, N = 8 in each group) infected withprotoscolices of Echinococcus granulosus. Viable protoscolices (N = 6 x 103) were cultured in vitro in 1640 medium and mortality was calculated daily. To determine the in vivo efficacy, mice were inoculated intraperitoneally with viable protoscolices and then treated once daily by gavage for three months with the alkaloids (50 mg kg-1 day-1) and albendazole (50 mg kg-1 day-1), separately and in combination (both alkaloids at 25 mg kg-1 day-1 and albendazole at 25 mg kg-1 day-1). Next, the hydatid cysts collected from the peritoneal cavity of the animals were weighed and serum IL-4, IL-2, and IgE levels were analyzed. Administration of alkaloids to cultured protoscolices showed significant dose- and time-dependent killing effects. The weight of hydatid cysts was significantly decreased upon treatment with each drug (P < 0.01), but the decrease was more prominent and the rate of hydatid cyst growth inhibition was much higher (76.1 percent) in the group receiving the combined treatments (18.3 ± 4.6 mg). IL-4 and total IgE were decreased (939 ± 447 pg/mL and 2.03 ± 0.42 IU/mL, respectively) in serum from mice treated with alkaloids and albendazole compared with the untreated control (1481 ± 619 pg/mL and 3.31 ± 0.37 IU/mL; P < 0.01). These results indicate that S. moorcroftiana alkaloids have protoscolicidal effects and the combination of alkaloids and albendazole has significant additive effects.

Cysticercosis in Domestic Animals and Rodents / 中国人兽共患病学报

Cysticercus cellulosae, C. bovis, and C. taiwanensis are the three species of cysticercosis of human taeniid with their adults worms Taenia solium, T. saginata saginata and T. s. asiatica respectively. C. cellulosae is prevalent in America, Europe and Asia, C. bovis in Africa, America and Asia and C. taiwanensis in Asia. The natural infection source is pig for C. cellulosae, cattle for C. bovis and pig and wild boar for C. taiwanensis. The predilection sites are muscles for C. cellulosae and C. bovis and liver for C. taiwanensis. While the prepatent periods of these three species were 60-70 days, 60-75 days and 28 days respectively. Most C. cellulosae and a few for C. bovis and C. taiwanensis survive in pig, while most C. bovis and a few for C. taiwanensis survive in cattle. In rodent, all three species have a long life. C. cellulosae and C. bovis migrate through blood and lymph vessels to the small intestinal wall and then to the body muscles while C. taiwanensis migrate through blood vessels to the small intestinal wall and then to the liver. The minimal effective dosage of praziquantel against cysticercosis should be 100 mg/kg daily for three consecutive days.

Experimental studies on small hooks preceding large hooks in the growth and development of Taenia solium metacestodes.

In the present study, we have determined the growth and development pattern of rostellar hooklets of Taenia solium cysticerci (Zhengzhou and Harbin strains) in three pigs (1 SEM and 2 L-SEM strains) 89-196 days post experimental infection. A total of 3,675 cysticerci were collected from 3 pigs, 3,007 (82%) of 3,675 cysticerci were evaginated by enzyme method. 439 (15%) evaginated cysticerci were carefully examined and measured after dehydration, staining, and mounting on microscopic slides. Among 439 cysticerci, 234 (53%) had pair rostellar hooks, 88 (20%) with unpair hooks, 60 (14%) only small (outer row) hooks, and 57 (13%) no hooks including 34 hooks were completely dropped and 23 no hooks developed. The number ranged from 10 to 17 pairs for pair hooks and 1 to 29 for unpair ones. The length and width of rostallar hooks on the scolex of cysticerci were usually larger in the pig with longer infection time. Moreover, cysticerci with pair and unpair rostellar hooks had only small hooks and no hooks were present on their scolices. However, cysticerci with only large (inner row) hooks were not found. These findings indicate that the growth and development of small hooks precedes that of the large hooks in the formation of the two-row pattern rostellar hook in Cysticercus cellulosae.

Studies on abnormality of metacestodes and adult worms of Taenia solium and Taenia saginata asiatica in rodents and pigs.

Abnormalities are not uncommon in Taenia saginata and T. solium. After examining 328 mature proglottids from 2 adult worms from two experimentally infected hamsters, 13 (4.0%) were found to have no genital pore but with numerous testes and several vas efferents; 1 (0.3%) one genital pore with one reproductive system; 12 (3.7%) one on each side with two sets of reproductive system; 17 (5.2%) two on one side with 2 sets of reproductive system; 8 (2.4%) one on one side and two on the other side with 3 sets of reproductive system; 2 (0.6%) two on each side with 4 sets of reproductive system; 4 (1.2%) three on one side with 3 sets of reproductive system, and 4 one on one side and three on the other side with 4 sets of reproductive system. Nine evaginated abnormal cysticerci of T. s. asiatica from three experimentally infected SCID mice each had two protoscoleces and a big bladder. From two experimentally infected pigs, one abnormal cysticercus was observed to have two invaginated canals each in one end. Another one had a neck-band behind the scolex and a big bladder. This paper is not only the first report of abnormality of T. solium from hamster but also the first one of abnormal cysticerci of T. s. asiatica from pigs and mice.

Baculovirus expression of the major surface antigen of Toxoplasma gondii and the immune response of mice injected with the recombinant P30.

The major surface antigen (P30) of the Toxoplasma gondii was expressed by an insect cell culture system infected with recombinant baculovirus. About 750 microg of purified (95% purity) P30 was obtained from a culture of 10(8) insect Sf21 cells. The recombinant P30 was used to immunize mice to induce immune response. Mice injected with the recombinant protein produced specific humoral and cellular immune responses. Immunization with P30 also prolonged the period of survival of mice infected by Toxoplasma. The average survival time of control group is 13.25+/-1.16 days, but are 16.13+/-2.1 days, 19.50+/-3.21 days, 20.38+/-3.38 days in different immunized groups, respectively.